Lewati ke konten utama
7,051 dokumen ditemukan (Menampilkan 1-20 | Halaman 1 dari 353)
Urutkan
# Judul Penulis Tahun Akses
Jurnal Institusi

UJI SITOTOKSIK TUMBUHAN OBAT DI HUTAN ADAT SINAGA SUMATERA UTARA

Wahana Forestra: Jurnal Kehutanan; Vol. 17 No. 1 (2022); 69-84
Fakultas Kehutanan Universitas Lancang Kuning, 2022DOI: 10.31849/forestra.v17i1.6531Copyright (c) 2022 Wahana Forestra: Jurnal Kehutanan
Toxicity test can be conduct using Artemia salina shrimp larvae.  For this reason do a research aimed to identifying 5 types of medicinal plants, and assessing the bioactivity content of five types of anticancer medicinal plants as cytotoxic...
Jurnal Institusi

Penerapan Kebijakan Izin Belajar Dan Tugas Belajar Bagi Aparatur Sipil Negara (ASN) Di Pemerintah Kota Pekanbaru

Jurnal Niara; Vol. 14 No. 1 (2021); 228-241
FAKULTAS ILMU ADMINISTRASI UNIVERSITAS LANCANG KUNING, 2021DOI: 10.31849/niara.v14i1.4047Copyright (c) 2021 Jurnal Niara
Penelitian ini dilatarbelakangi oleh surat edaran MENPANRB No 4 Tahun 2013 Tentang pelaksanaan izin belajar dan tugas belajar di setiap Instansi. Tujuan penelitian ini untuk menganalisis penerapan kebijakan izin belajar dan tugas belajar bagi Aparatu...
Jurnal Institusi

Mispronunciation and Substitution of Mid-high Front and Back Hausa Vowels by Yorùbá Native Speakers

REiLA : Journal of Research and Innovation in Language; Vol. 3 No. 1 (2021): REiLA : Journal of Research and Innovation in Language; 1-16
The Institute of Research and Community Service (LPPM) - Universitas Lancang Kuning, 2021DOI: 10.31849/reila.v3i1.6107Copyright (c) 2021 REiLA : Journal of Research and Innovation in Language
The mid short vowels: /e/ and /o/ are among the vowels shared between Hausa and Yorùbá but differ in Hausa mid-high long, front and back vowels: /e:/ and /o:/. The phonemic differences in the two languages have caused learning difficulties among th...
PubMed

The complete mitochondrial genome of Artemia salina Leach, 1819 (Crustacea: Anostraca)

Mitochondrial DNA B Resour
Taylor & Francis, 2021DOI: 10.1080/23802359.2021.1992315https://creativecommons.org/licenses/by/4.0/
In the study, the complete mitochondrial genome of Artemia salina was reported for the first time. The mitochondrial genome of A. salina is 15,762 bp in length, with the typical structure of 13 protein-coding genes (PCGs), 22 transfer RNA genes (tR...
PubMed

Artemia salina as an animal model for the preliminary evaluation of snake venom-induced toxicity

Toxicon X
Elsevier, 2021DOI: 10.1016/j.toxcx.2021.100082https://creativecommons.org/licenses/by-nc-nd/4.0/
Lethality and cytotoxicity assays of snake venoms and their neutralization by antivenom require many mice for the experiments. Recent developments have prompted researchers to seek alternative strategies that minimize the use of mice in line with Rus...
PubMed

Efficacy of Artificial Tears Based on an Extract of Artemia salina Containing Dinucleotides in a Rabbit Dry Eye Model

Int J Mol Sci
Multidisciplinary Digital Publishing Institute (MDPI), 2021DOI: 10.3390/ijms222111999https://creativecommons.org/licenses/by/4.0/
(1) Background: Artemia salina is a brine shrimp containing high concentrations of dinucleotides, molecules with properties for dry eye treatment. For this reason, the purpose of the study was to evaluate the effect of the artificial tears based on a...
PubMed

Early dolichyl sugar synthesis during differentiation of non-growing brine-shrimp (Artemia salina) embryos.

Biochem J
Portland Press Ltd, 1981DOI: 10.1042/bj1980429
Incubation of cell-free extracts of Artemia salina with sugar nucleotides resulted in the formation of dolichyl derivatives. These enzymic activities were detected early in the development of the encysted Artemia embryos. Dolichyl sugars seemed to ac...
PubMed

The sequence of the 5S ribosomal RNA of the crustacean Artemia salina

Nucleic Acids Res
Oxford University Press, 1981DOI: 10.1093/nar/9.19.5141© IRL Press Limited, 1 Falconberg Court, London W1V 5FG, U.K.
The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU (OH).
PubMed

Methanolic Extract of Artemia salina Eggs and Various Fractions in Different Solvents Contain Potent Compounds That Decrease Cell Viability of Colon and Skin Cancer Cell Lines and Show Antibacterial Activity against Pseudomonas aeruginosa

Evid Based Complement Alternat Med
Wiley, 2019DOI: 10.1155/2019/9528256https://creativecommons.org/licenses/by/4.0/
Artemia salina, crustaceans of class Branchiopoda and order Anostraca, are living and reproducing only in highly saline natural lakes and in other reservoirs where sea water is evaporated to produce salt. Artemia salina eggs can be purchased from pet...
PubMed

Monitoring the Effect of Metal Ions on the Mobility of Artemia salina Nauplii

Biosensors (Basel)
Multidisciplinary Digital Publishing Institute (MDPI), 2011DOI: 10.3390/bios1020036http://creativecommons.org/licenses/by/3.0/
This study aims to measure the effect of toxic aqueous solutions of metals on the mobility of Artemia salina nauplii by using digital image processing. The instrument consists of a camera with a macro lens, a dark chamber, a light source and a laptop...
PubMed

Synthesis, Characterization, and Ecotoxicology Assessment of Zinc Oxide Nanoparticles by In Vivo Models

Nanomaterials (Basel)
Multidisciplinary Digital Publishing Institute (MDPI), 2024DOI: 10.3390/nano14030255https://creativecommons.org/licenses/by/4.0/
The widespread use of zinc oxide nanoparticles (ZnO NPs) in multiple applications has increased the importance of safety considerations. ZnO NPs were synthesized, characterized, and evaluated for toxicity in Artemia salina and zebrafish (Danio rerio)...
PubMed

Settling taxonomic and nomenclatural problems in brine shrimps, Artemia (Crustacea: Branchiopoda: Anostraca), by integrating mitogenomics, marker discordances and nomenclature rules

PeerJ
PeerJ, Inc, 2021DOI: 10.7717/peerj.10865https://creativecommons.org/licenses/by/4.0/
High morphological plasticity in populations of brine shrimp subjected to different environmental conditions, mainly salinity, hindered for centuries the identification of the taxonomic entities encompassed within Artemia. In addition, the mismatch b...
PubMed

Assessment of the biological effect of metal ions and their complexes using Allium cepa and Artemia salina assays: a possible environmental implementation of biological inorganic chemistry

J Biol Inorg Chem
2022DOI: 10.1007/s00775-022-01963-2https://creativecommons.org/licenses/by/4.0/
The pollution of aquatic ecosystems due to the elevated concentration of a variety of contaminants, such as metal ions, poses a threat to humankind, as these ecosystems are in high relevance with human activities and survivability. The exposure in he...
PubMed

Isolation and characterization of two acidic proteins of 60s ribosomes from Artemia salina cysts.

Proc Natl Acad Sci U S A
National Academy of Sciences, 1975DOI: 10.1073/pnas.72.12.4744
60S ribosomes from encysted gastrulae of the brine shrimp Artemia salina contain two acidic proteins, which are homologous to the Escherichia coli proteins L7 and L12. The proteins were purified and characterized with respect to molecular weight, ami...
PubMed

Investigation of Metal Toxicity on Microalgae Phaeodactylum tricornutum, Hipersaline Zooplankter Artemia salina, and Jellyfish Aurelia aurita

Toxics
Multidisciplinary Digital Publishing Institute (MDPI), 2023DOI: 10.3390/toxics11080716https://creativecommons.org/licenses/by/4.0/
The escalating global anthropogenic activities associated with industrial development have led to the increased introduction of heavy metals (HMs) into marine environments through effluents. This study aimed to assess the toxicity of three HMs (Cr, C...
PubMed

Comparison of Artemia salina and Escherichia coli ribosome structure by electron microscopy.

Proc Natl Acad Sci U S A
National Academy of Sciences, 1978DOI: 10.1073/pnas.75.6.2829
The structure of eukaryotic Artemia salina and prokaryotic Escherichia coli ribosomes has been compared by electron microscopy. Despite the established differences in size and in the amount and proportion of the protein and RNA moieties, both types o...
PubMed

Toxicity of UV Filter Benzophenone-3 in Brine Shrimp Nauplii (Artemia salina) and Zebrafish (Danio rerio) Embryos

J Xenobiot
Multidisciplinary Digital Publishing Institute (MDPI), 2024DOI: 10.3390/jox14020032https://creativecommons.org/licenses/by/4.0/
The benzophenone (BP) family, including oxybenzone (BP-3), a prevalent sunscreen ingredient and environmental contaminant, has raised concerns since the year 2005. This study investigated oxybenzone toxicity in zebrafish (Danio rerio) eleutheroembryo...
PubMed

Role of rotifer (Brachionus plicatilis) and Artemia (Artemia salina) nauplii in the horizontal transmission of a natural nervous necrosis virus (NNV) reassortant strain to Senegalese sole (Solea senegalensis) larvae

Vet Q
Taylor & Francis, 2020DOI: 10.1080/01652176.2020.1810357https://creativecommons.org/licenses/by/4.0/
BACKGROUND: Marine invertebrates are provided as a first feed for marine fish larvae because of their strict nutritional requirements, despite also being a potential source of infectious agents. AIM: To assess horizontal transmission of a nervous nec...
PubMed

Polypeptide chain initiation in eukaryotes: initiation factor MP in Artemia salina embryos.

Proc Natl Acad Sci U S A
National Academy of Sciences, 1975DOI: 10.1073/pnas.72.10.3947
The activity of IF-MP, a polypeptide chain initiation factor that forms a ternary complex with eukaryotic initiator Met-tRNA and GTP and promotes binding of the initiator to 40S ribosomes, is very low in undeveloped Artemia salina embryos but increas...
PubMed

Comparing cestode infections and their consequences for host fitness in two sexual branchiopods: alien Artemia franciscana and native A. salina from syntopic-populations

PeerJ
PeerJ, Inc, 2015DOI: 10.7717/peerj.1073https://creativecommons.org/licenses/by/4.0/
The American brine shrimp Artemia franciscana is invasive in the Mediterranean region where it has displaced native species (the sexual A. salina, and the clonal A. parthenogenetica) from many salt pond complexes. Artemia populations are parasitized ...